RNA-based CRISPR-CAS9 gene editing is a vector-free approach that is required for therapeutic perspectives. However, from a practical point of view, what appears as a major challenge to engineer primary cells, is actually also an efficient and smart solution for numerous other knock-out projects on cell lines. We see here why and how.
CAS9 mRNA and single guide RNA
Several studies using single gRNA have consistently reported higher editing rates than those using dual gRNAs (TracrRNA+crRNA).
Combination of 2′ O Methyl (2’OMe) and phosphorothioate (ps) oligonucleotide modifications bring nucleases resistance for a more robust single guide RNA. It has been shown in June 2015 (10.1038/nbt.3290), and illustrated above. The red stars are 2’OMe and PS modifications.
Taking all together, the long single guide RNA (about 80-100nt), manufactured and HPLC purified by Trilink, is the top solution to ensure on-target gene editing
Of course, a good guide is not enough. Delivery of the CAS9 endonuclease is also a major point. Trilink, the pioneer to provide CAS9 mRNA, has made advanced optimisations
Optimisations are notably 2 NLS to improve the CAS9 protein localisation into the nucleus, U-depleted mRNA coding for the CAS9 to increase the stability into the cells and thus success in generating the specific indel. And of course, the Trilink mRNA contains the famous optimised UTRs and CleanCap capping to boost protein production into the cells. This has become a real gold standard for Mammalian cells.
Furthermore, the license free 5-methoxy-UTP substitution reduces the immune response of the cells, another challenge that we can now face with the Trilink CAS9 mRNA.
Even with this high level of expertise, Trilink CAS9 mRNA also remains the cheapest product on the market and can be provided as GMP upon request for therapeutics purposes.
And what else?
How to proceed?
It’s very straightforward.
First of all, is the sgRNA design that ensures the specificity of the knock-out. It is usually a 20nt-long targeted sequence (without the PAM): 5’-NNNNNNNNNNNNNNNNNNNN-3’. There are a lot of tools to determine that sequence. I would suggest the following because it is simple to use and with a clear display of the result: http://crispr.dbcls.jp/
A truncated version of 18nt is also possible according to Fu et al.. For that, just remove the 2nt at 5′. Surprisingly, it would appear to improve specificity a little bit.
Then, we add an optimized (Dang et al.) common sequence. The finally sgRNA is 5’NNNNNNNNNNNNNNNNNNNNGUUUCAGAGCUAUGCUGGAAACAGCAUAGCAAGUUG
AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU3’.
Combination of 2′ O Methyl (2’OMe) and phosphorothioate (ps) oligonucleotide modifications that bring nucleases resistance is applied as below.
5’2OMe[N(ps)N(ps)N(ps)]NNNNNNNNNNNNNNNNNGUUUCAGAGCUAUGCUGGAAA
CAGCAUAGCAAGUUGAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA
GUCGGUGC2OMe[U(ps)U(ps)U(ps)]U3’.
We provide from 1 umole starting synthesis scale, meaning 0.5-1mg final yield, with Trilink HPLC purification in 4 weeks.
Useful related tools
The 2 final challenge before achieving success, is the delivery of the RNA (sgRNA+CAS9 mRNA) into the cells and the single-cell isolation to catch the wished-for knock-out events.
We provide a transfection reagent developped and optimised for RNA. It has been used notably on primary cells such as fibroblasts and stem cells, and is called Stemfect. Our eGFP mRNA can be used as control.
For single cell isolation, we provide an innovative tool called the Smart Aliquotor. It allow you to isolate 30 clones. You just introduce the cells diluted in media into the biochips and let them grow.
I’d like to share this with you because I think that the combination of smart tools for this RNA-based CRISPR-CAS9 gene editing will support you in your projects, make your experiences easier, and finally enable you to get your results faster.
Feel free contact me for any questions and assistance, or to explore our wide CRISPR offer.
