Skip to main content
Filters

Results for Viral Vectors & Particles ( 1707 )

    • Ref: 78794
      Sizes: 500 µl x 2
      From: DKK8,655.00

      Cas9 Lentiviruses (Inducible Tet-On) are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses transduce cells with the Streptococcus pyogenes Cas9 gene under a tight TRE tetracycline-inducible promoter. Cas9 expression in the transduced cells is induced with doxycycline treatment, allowing temporal control of its expression, and when combined with sgRNA targeting gene(s) of interest allows gene editing events to be temporally controlled. The lentivirus vector also contains a geneticin selection gene.

      Product detail
    • From: DKK8,610.00

      Please note this product may be subject to fees, we invite you to contact your local office. The STAT6 Luciferase Reporter Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a firefly luciferase reporter driven by multiple copies of STAT6 (signal transducer and activator of transcription 6) responsive elements located upstream of the minimal TATA promoter. The lentiviruses also contain a puromycin selection marker. After transduction, the cellular STAT6 signaling pathway can be monitored by measuring the luciferase activity.

      Product detail
    • Ref: 78871
      Sizes: 500 µl x 2
      From: DKK4,695.00

      Please note this product may be subject to fees, we invite you to contact your local office. This AAV-DJ Scrambled shRNA (short-hairpin RNA) Control co-expresses a 29-mer scrambled shRNA sequence under the control of a U6 promoter, and Turbo GFP under the control of a CMV promoter to assess the efficacy of transduction.

      Product detail
    • Ref: 78893
      Sizes: 500 µl x 2
      From: DKK8,963.00

      The BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and 5 sgRNA (single guide RNA) targeting human BCMA (B-cell maturation antigen) driven by a U6 promoter (see Table 1 for sgRNA sequences). The integrating lentivirus integrates randomly into the cellʹs genome to express both the Cas9 and sgRNAs.  Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. List of sgRNA sequences in the BCMA CRISPR/Cas9 Lentivirus. Gene Target: Primer ID: sgRNA Sequence: TNFRSF17 (BCMA) TNFRSF17-1 CCTCTAACATGTCAGCGTTA TNFRSF17 (BCMA) TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17 (BCMA) TNFRSF17-3 C

      Product detail
    • From: DKK8,963.00

      The BCMA CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and with 5 sgRNA (single guide RNA) targeting human BCMA (B- cell maturation antigen) driven by a U6 promoter.  Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step.  The lentiviruses also contain a puromycin selection marker. The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, Cas9 is not permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cellʹs genome. Despite transient expression of Cas9 and sgRNA, knockout cell lines can still be

      Product detail
    • Ref: SL100840-SC
      Sizes: 10 µL
      From: DKK2,040.00

      Product detail
    • Ref: SL100261
      Sizes: 1 x 25 µL, 2 x 25 µL
      From: DKK2,865.00

      Product detail
    • Ref: SL100262
      Sizes: 1 x 25 µL, 2 x 25 µL
      From: DKK2,865.00

      Product detail
    • Ref: SL100263
      Sizes: 1 x 25 µL, 2 x 25 µL
      From: DKK2,865.00

      Product detail