Skip to main content

Results for Lentivirus ( 714 )

    • Ref: SL100314
      Sizes: 1 x 25 µL, 2 x 25 µL
    • Ref: SL100315
      Sizes: 1 x 25 µL, 2 x 25 µL
    • Ref: 78902
      Sizes: 500 µl x 2

      VSIG4 (V-set and immunoglobulin domain containing 4) Lentivirus are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain human VSIG4 (NM_007268.3) driven by a CMV promoter and a puromycin selection marker.

      Product detail
    • Ref: 78903
      Sizes: 500 µl x 2

      LAIR1 (leukocyte-associated immunoglobulin-like receptor 1) Lentivirus are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain human LAIR1 (NM_ 002287.6) driven by a CMV promoter and puromycin selection marker.

      Product detail
    • Ref: 78909
      Sizes: 500 µl x 2

      DLL3 (Delta-like protein 3) Lentivirus are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain human DLL3 (NM_016941.3) driven by a CMV promoter and a puromycin selection marker.

      Product detail
    • Ref: 82122
      Sizes: 500 µl x 2

      Please note this product may be subject to fees, we invite you to contact your local office. The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC

      Product detail
    • Ref: CoV-HT
      Sizes: 500 µl HT

      500 ul of SARS-CoV particles, Luc, GFP, or RFP reporter (High Titer)

      Product detail
    • Ref: CoV2-HT
      Sizes: 500 µl HT

      500 ul of SARS-CoV-2(Luc) particles (Variant) Luc, GFP, or RFP reporter (High Titer)

      Product detail
    • 500 ul of SARS-CoV-2(Luc/GFP) particles (Variant) Luc/GFP Dual reporter (High Titer)

      Product detail