Results for Lentivirus ( 684 )
- From: €1,297.00
DLL3 (Delta-like protein 3) Lentivirus are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain human DLL3 (NM_016941.3) driven by a CMV promoter and a puromycin selection marker.
- From: €1,091.00
Please note this product may be subject to fees, we invite you to contact your local office. The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC