Viral Vectors & Particles

VSIG4 (V-set and immunoglobulin domain containing 4) Lentivirus are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain human VSIG4 (NM_007268.3) driven by a CMV promoter and a puromycin selection marker.

LAIR1 (leukocyte-associated immunoglobulin-like receptor 1) Lentivirus are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain human LAIR1 (NM_ 002287.6) driven by a CMV promoter and puromycin selection marker.

DLL3 (Delta-like protein 3) Lentivirus are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain human DLL3 (NM_016941.3) driven by a CMV promoter and a puromycin selection marker.

AAV-DJ MBP eGFP particles transduce enhanced Green Fluorescent Protein (eGFP) under the control of a 1.3 Kb MBP (myelin basic protein) promoter that drives GFP reporter expression in oligodendrocytes.

Please note this product may be subject to fees, we invite you to contact your local office. The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC

Please note this product may be subject to fees, we invite you to contact your local office. These AAV-DJ particles constitutively express the firefly (Photinus pyralis) luciferase under the control of a SYN1 promoter.

Please note this product may be subject to fees, we invite you to contact your local office. AAV-DJ SP-B Luciferase particles transduce firefly (Photinus pyralis) luciferase under the control of a SP-B (Surfactant protein B) promoter that drives luciferase reporter expression mainly in epithelial lung cells.

AAV8-CMV-Luc is a pre-packaged rAAV in serotype 8 (with capsid from AAV serotype 8 and 2xITR from AAV serotype 2) which over-express firefly luciferase under CMV promoter. Ready to use format.

AAV5-CMV-Luc is a pre-packaged rAAV in serotype 5 (with capsid from AAV serotype 5 and 2xITR from AAV serotype 2) which over-express firefly luciferase under CMV promoter. Ready to use format.