Results for Lentivirus ( 714 )
- From: €6,211.00
The Spike (XBB.1.16, Omicron Variant) (SARS-CoV-2) Pseudotyped Lentiviruses are replication incompetent, HIV-based lentiviral particles. They were produced with SARS-CoV-2 Spike (Genbank Accession #QHD43416.1 containing all the XBB.1.16 mutations; see below for details) as the envelope glycoprotein instead of the commonly used VSV-G. These pseudovirions contain firefly luciferase driven by a CMV promoter (Figure 1), allowing the spike-mediated cell entry to be measured by luciferase activity. The Spike (XBB.1.16, Omicron Variant) (SARS-CoV-2) pseudoviruses can be used to measure the activity of a neutralizing antibody against the SARS-CoV-2 Omicron XBB.1.16 variant. The Spike Omicron XBB.1.16 pseudoviruses have been validated for use with ACE2-HEK293 target cells (which overexpress ACE2; >BPS Bioscience #79951).
- From: €1,229.00
The Spike (XBB.1.16 Omicron Variant) (SARS-CoV-2) Pseudotyped Lentiviruses are replication incompetent, HIV-based lentiviral particles. They were produced with SARS-CoV-2 Spike (Genbank Accession #QHD43416.1 containing all the Omicron XBB.1.16 mutations; see below for details) as the envelope glycoprotein instead of the commonly used VSV-G. These pseudovirions contain eGFP driven by a CMV promoter (Figure 1), allowing the spike-mediated cell entry to be measured by the eGFP fluorescence signal. The Spike (XBB.1.16, Omicron Variant) (SARS-CoV-2) pseudotyped lentivirus can be used to measure the activity of neutralizing antibody against SARS-CoV-2 XBB.1.16. The Spike Omicron XBB.1.16 pseudoviruses have been validated for use with ACE2-HEK293 target cells (which overexpress ACE2; BPS Bioscience #79951).
- From: €6,211.00
The Spike (XBB.1.16 Omicron Variant) (SARS-CoV-2) Pseudotyped Lentiviruses are replication incompetent, HIV-based lentiviral particles. They were produced with SARS-CoV-2 Spike (Genbank Accession #QHD43416.1 containing all the Omicron XBB.1.16 mutations; see below for details) as the envelope glycoprotein instead of the commonly used VSV-G. These pseudovirions contain eGFP driven by a CMV promoter (Figure 1), allowing the spike-mediated cell entry to be measured by the eGFP fluorescence signal. The Spike (XBB.1.16, Omicron Variant) (SARS-CoV-2) pseudotyped lentivirus can be used to measure the activity of neutralizing antibody against SARS-CoV-2 XBB.1.16. The Spike Omicron XBB.1.16 pseudoviruses have been validated for use with ACE2-HEK293 target cells (which overexpress ACE2; BPS Bioscience #79951).
- From: €1,154.00
Cas9 Lentiviruses (Inducible Tet-On) are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses transduce cells with the Streptococcus pyogenes Cas9 gene under a tight TRE tetracycline-inducible promoter. Cas9 expression in the transduced cells is induced with doxycycline treatment, allowing temporal control of its expression, and when combined with sgRNA targeting gene(s) of interest allows gene editing events to be temporally controlled. The lentivirus vector also contains a geneticin selection gene.
- From: €1,148.00
Please note this product may be subject to fees, we invite you to contact your local office. The STAT6 Luciferase Reporter Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a firefly luciferase reporter driven by multiple copies of STAT6 (signal transducer and activator of transcription 6) responsive elements located upstream of the minimal TATA promoter. The lentiviruses also contain a puromycin selection marker. After transduction, the cellular STAT6 signaling pathway can be monitored by measuring the luciferase activity.
- From: €1,195.00
The BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and 5 sgRNA (single guide RNA) targeting human BCMA (B-cell maturation antigen) driven by a U6 promoter (see Table 1 for sgRNA sequences). The integrating lentivirus integrates randomly into the cellʹs genome to express both the Cas9 and sgRNAs. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. List of sgRNA sequences in the BCMA CRISPR/Cas9 Lentivirus. Gene Target: Primer ID: sgRNA Sequence: TNFRSF17 (BCMA) TNFRSF17-1 CCTCTAACATGTCAGCGTTA TNFRSF17 (BCMA) TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17 (BCMA) TNFRSF17-3 C
- From: €1,195.00
The BCMA CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and with 5 sgRNA (single guide RNA) targeting human BCMA (B- cell maturation antigen) driven by a U6 promoter. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, Cas9 is not permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cellʹs genome. Despite transient expression of Cas9 and sgRNA, knockout cell lines can still be